To avoid upload of initial Solexa raw fastq data with large file size, mirTools 2.0 only support specified input file (*.fa or *.gz or *.zip, Max 30M) with the follow format:

An example sequence tag format is:
>sample_260_x80 ("sample_260" represents an unique ID, "80" is read counts)
CATTTATTATTTATCTTATTCCTTCTTCTTTTTTA

In order to generate the proper input format of mirTools 2.0, here, a Perl script is provided.

Description: Perl script used to filter low quality short reads, remove polyA, trim 3'/5' adapter and generate the the proper input format of mirTools 2.0
Usage: perl Adapter_trim.pl [options] >outputfile
Options:
-i  <file> Short reads file in fastq format
-n <str>  Sample name; default="sample"
-x <str>  5' adaptor sequence, default="GTTCAGAGTTCTACAGTCCGACGATC";
-y <str>  3' adaptor sequence, default="TCGTATGCCGTCTTCTGCTTG";
-f  <int>  Fastq file format: 1=Sanger format; 2=Solexa/Illumina 1.0 format; 3=Illumina 1.3+ format; default=2;
-h           Help
Examples: perl Adapter_trim.pl -i sample.fq -n "newid" -f 1 >outputfile
                perl Adapter_trim.pl -i sample.fq -x "ATCGGGCT" -y "TCGTAT" -f 3 >outputfile